fbpx
072-141 00 77 / christina@sagersten.nu

Har jag hittat farfars farfar nu?

Det kom en fråga om Y-DNA som jag svarade på i Fredagsfrågan på min Facebook-sida i fredags, men jag vill passa på att gå lite djupare i mitt svar.

Själva frågeställningen var: Om jag har en person som jag matchar med GD=0 på Y37 och som jag dessutom delar en del autosomaltDNA med, har jag hittat farfars farfar då?


VI BÖRJAR MED BEGREPPEN

Y- DNA ärvs ganska oförändrat från far till son. Det gör att vi kan följa raka fädernelinjer långt tillbaka i tiden. Alla nu levande män på hela jorden härstammar från en man, Y-DNA Adam brukar han kallas, som levde någon gång för mellan 237.000 och 581.000 år sedan.

Haplogrupp är en genetisk befolkningsgrupp av människor som delar en gemensam ana på det raka fädernet eller mödernet

SNP (single-nucleotide polymorphism) är en position på DNAt där det skett en mutation. T.ex. där det tidigare varit ett A är det nu ett T.

STR (short tandem repeat) uppkommer när ett mönster av två eller fler baspar upprepas och repetitionerna ligger bredvid varandra. Ex: AATGAATGAATGAATGAATG – här upprepas AATG fem gånger. D.v.s. vi har ett STR värde på 5.

Y37:  Y37 är ett test du som man kan göra hos t.ex. Family Tree DNA. Då testas ditt Y-DNA och värdet 37 visar att testet tittar på 37 markörer (ställen) på din Y-kromosom. De tittar på samma ställe för alla män och tittar på STR-värdet, d.v.s räknar antalet gången en sekvens upprepas. Du kan testa dina STR-värden på 12, 37, 67 och 111-markörers nivå.

STR-test: ett STR-test ger dig en uppskattning om vilken haplogrupp du tillhör. Y37 är ett STR-test

SNP-test: ett SNP test testar mutationer och du får svar på om du har dem eller inte. SNP-tester fastställer haplogrupper. Det mest omfattande SNP-test du kan ta hos FTDNA är BIG-Y500. Då är du med och bygger nya grenar i Y-DNA-trädet. Du kan även testa enstaka SNPer eller SNP-paket (Obs! har du tagit ett BIG-Y500 behöver du inte testa enstaka SNPer eller SNP-paket)

GD: Genetisk distans. Skillnaderna mellan två Y-STR-tester. Har du en match på Y37 som har GD=0 så har ni exakt samma värde på de 37 markörerna. Om GD=1 så är det ett värde som skiljer sig åt

Autosomalt DNA: kärn-DNA, det DNA som finns i de 22 kromosomparen i cellkärnan

TILLBAKA TILL FRÅGAN:

Fråga:
Om jag har en person som jag matchar med GD=0 på Y37 och som jag dessutom delar en del autosomaltDNA med, har jag hittat farfars farfar då?

Svar:
Att testa ett Y-37 ger dig en uppskattad halplogrupp. Om du har en match på din Y-DNA lista som har GD=0 så har ni inga skillnader på de 37 testade markörerna och ni delar en gemensam anfader någon gång i historien.

Till exempel så får min fädernelinje resultatet I1-M253 på ett Y37. I1 är den grova grenen på haplogruppsträdet jag tillhör medan M253 är en SNP. Observera att med ett Y37 har jag inte testat om jag verkligen har mutationen M253, men mina STR-värden gör att det är troligt.

En match som jag har GD=0 med på Y37 kan ha den gemensamt anan som är min farfars farfar, men den kan också vara släkt med mig via en person som levde för 1000 år sedan. Det vet jag inte. Det enda jag med säkerhet kan säga är att vi delar samma ana. Någon gång.

Att man delar Y-DNA och autosomalt DNA behöver inte betyda att de kommer från samma grenar i släktträdet. En ana som levde för 1000 år sedan syns knappast i det autosomala DNAt men kan ge ett GD=o på Y37. Så det kan vara så att det autosomala DNAt man delar kommer från farmors sida i släktträdet. Det är det som är det luriga.

Så du kan inte säga att du hittat farfars farfar utifrån att ni har GD=0 på Y37. Men du kan inte utesluta att det inte är farfars farfar heller.

Jag fick en kommentar på Facebook-inlägget som belyser detta klockrent:
“Jag har haft i flera år en Y37 träff på GD0 (och GD1 på Y67), och vi har båda varsin en manslinje ner till 1630-talet och dessutom heter de efternamn Pålsson på två från början finska släkter. Men vid ett Y111-resutlat matchar vi plötsligt varandra inte alls, och våra BigY skiljer sig på ca 900 år från varandras, efter analys på YFull, vilket blev lite snopet…”

Mitt tips för att hitta farfars farfar är att fortsätta jobba med det autosomala DNAt.

(källa i inlägget är ISOGG.org/wiki)

Lämna ett svar

Stäng meny